Zoospore-free fluids were prepared from suspensions at a density of 10⁴ zoospores ml^-1 or higher of Phytophthora nicotianae (ZFFnic), P. capsici (ZFFcap), P. hydropathica (ZFFhyd), P. sojae (ZFFsoj) and Pythium aphanidermatum (ZFFaph) and evaluated in three phytopathosystems. Inoculation of annual vinca (Catharanthus roseus) with suspensions containing an average of one zoospore of P. nicotianae in any of the four ZFFs resulted in significantly higher infection (P < 0.001) compared to the control (SDW). Specifically, percentages of sites infected were 39%, 21%, 11%, and 15% for ZFFaph_, ZFFhyd, ZFFnic, and ZFFsoj, respectively compared to 3% for SDW (Figure 1A). Similarly, ZFFaph, ZFFhyd, ZFFnic and ZFFsoj stimulated infection of lupine (Lupinus polyphyllus) by P. sojae (Figure 1B), while ZFFcap and ZFFsoj stimulated infection of soybean (Glycine max) by P. sojae (Figure 1C). These results indicate that ZFF from the different Phytophthora species and Py. aphanidermatum contained one or more signals stimulating zoosporic infection by P. nicotianae and P. sojae that are active across species boundaries.

Many plants are attacked by multiple oomycete species 1 . The ability of oomycete pathogens to benefit from the presence of related (or unrelated) species is presumably a selective advantage, especially if the diverse pathogens are competing for a limited resource (i.e. the host plant tissue) and/or the initial population density of each individual pathogen population is low. Such self-interested cooperation may have further advantages if the effector molecules released by each pathogen species have complementary or synergistic capabilities for suppressing plant defenses.

To determine whether ZFF may also have cross-species activity in regulating zoospore aggregation, fresh zoospores of P. nicotianae and P. sojae at a concentration (2 × 10³ ml^-1) below normal aggregation thresholds (approx. 10⁶ ml^-1) were cross incubated in multiwell plates with ZFFsoj or ZFFnic and compared with those in SDW. Zoospores of P. nicotianae in ZFFsoj and those of P. sojae in ZFFnic aggregated (Figure 2C and 2G) as if they were in ZFF produced by their own species. As expected, zoospores of neither species aggregated in SDW (Figure 2D and 2H). ZFFcap and ZFFaph did not stimulate zoospore aggregation by P. nicotianae or P. sojae zoospores. However, they did stimulate germination of cysts of both P. nicotianae and P. sojae (Figure 2A, B, E, F), which may explain their activity in promoting plant infection (Figure 1). It was interesting that zoospores of P. capsici did not aggregate even at a density of 10⁶ zoospores ml^-1. These results indicate that the signal(s) involved in aggregation are somewhat species-restricted and may be different from those mediating the infection process.

To test whether AI-2 may be involved in zoospore communication and promotion of plant infection, purified AI-2 was used in place of ZFF. AI-2 was tested at a wide concentration range of 0.01 μM -1 mM for its effects on P. nicotianae zoospore behaviors and plant infection; the concentration of AI-2 in ZFF was estimated to be less than 2 μM 21 . Under the microscope, an increased number of zoospores treated with AI-2 lysed before encystment and failed to germinate as the AI-2 concentration was increased (Table 1). Zoospore aggregation was not observed at any concentration tested. In infection experiments with annual vinca, AI-2 did not promote single zoospore infection at any concentration. Interestingly, AI-2 induced hypersensitive response (HR)-like micro-lesions on the inoculated sites at 100 μM and higher. These results indicated that AI-2 was not responsible for any of the zoospore signals found in ZFF.

As a complementary test for the ability of AI-2-like molecules to mediate zoospore communication and promote plant infection, we cloned and silenced the ribose phosphate isomerase (RPI) gene of P. capsici. RPI converts ribose-5-phosphate to ribulose-5-phosphate, which can spontaneously convert to AI-2-like molecules under physiological conditions 28 . RPI was proposed to be responsible for production of AI-2-like molecules in zoosporic pathogens 21 . To silence the RPI gene of P. capsici, protoplasts of P. capsici were treated with RPI dsRNA. If RPI had a role in production of zoospore signaling molecules, RPI-silenced lines would be expected to require much higher zoospore concentrations to infect plants than the wild type due to reduced or blocked AI-2 production by the inocula. One third of the 48 T₀ lines regenerated 7 days after dsRNA exposure showed no or decreased expression with RPI compared to the endogenous control actin detected using RT-PCR. Half of these silenced or down regulated RPI lines retained the same reduced transcript levels two weeks after being transferred to fresh media (T₁) (Figure 3E). Five T₁ lines were simultaneously tested for zoospore threshold for infection. The resulting disease incidences were very similar to those produced by wild type P. capsici at zoospore inoculum concentrations ranging from 10² to 10⁴ ml^-1 (Figure 3A-D) (P = 0.705; P = 0.065; P = 0.598, respectively). These results indicate that RPI silencing had no significant impact on zoospore communication during infection. The ZFF activity of the silenced lines was not evaluated due to the transient nature of dsRNA-mediated silencing 41 and insufficient numbers of T₁ zoospores for ZFF production. Nevertheless, these findings are consistent with the conclusion that AI-2-like molecules that might be produced via the action of RPI are not required for infection at low inoculum densities.

The function of AI-2-like activities produced by zoosporic oomycetes remains unclear although it regulates bacteria quorum sensing 21 . Two-way communication has been observed between eukaryotes and bacteria such as Leguminosae and bacterial rhizobia 42 and between mycorrhiza and Streptomyces 43 . In the former case, plants release flavonoids that bind LysR-family transcriptional regulators in the bacteria, leading to the production of Nod factor that facilitates nitrogen fixation. In the latter case, fungal metabolites stimulate the bacteria to produce auxofuran which promotes growth of both the fungus and the host plants. Perhaps zoosporic oomycetes utilize AI-2 to attract quorum sensing bacteria which subsequently release factors that facilitate plant infection. Indeed, bacteria have been shown to benefit sporangium production by zoosporic oomycetes 44 .

Acyl-homoserine lactones (AHLs), or bacterial autoinducer 1, are utilized by zoospores of the green seaweed Enteromorpha (Ulva) for communication in the search for settlement surfaces 45 . A bioassay was performed using the Agrobacterium tumefaciens reporter strain KYC55/pJZ410/pJZ384/pJZ372 46 in plate and spectrophotometric tests to determine whether this molecule is present in ZFF. LacZ activity was detected in all four positive control plates at nM concentrations of AHL but not in ZFFnic or ZFFsoj prepared from zoospore suspensions at > 10⁴ spores ml^-1 nor in concentrated extracts from them obtained with ethyl acetate. These results indicate that zoospores from these oomycete species do not produce AHLs which therefore cannot be responsible for any ZFF activity.

To begin to characterize the signal molecules in ZFF we tested their temperature sensitivity. ZFFnic did not stimulate zoospore aggregation after a freeze-thaw or heat treatment, suggesting that the molecule promoting this behavior may be a protein or lipoprotein that is sensitive to heat and freezing. On the other hand, freeze-thaw did not affect the activity of ZFFnic in promoting plant infection by zoospores (data not shown). In addition, ZFFnic boiled for 5 minutes remained as active as the untreated in promoting infection (Figure 4), indicating that the molecule which stimulates plant infection is temperature insensitive and different from that involved in aggregation.

Four Phytophthora species, P. nicotianae (1B11), P. sojae (28G4), P. capsici (24F4), P. hydropathica (37E6) and one Pythium species Py. aphanidermatum (18H7) were used in this study. These species are distinct in morphology and genetics 2 47 . Specifically, P. nicotianae, P. capsici and Py. aphanidermatum have broad host ranges while P. sojae has a restricted host range, generally infecting only soybeans and lupines. P. hydropathica (37E6) originated from irrigation water and is a pathogen of nursery plants 48 . The isolates were maintained on clarified vegetable juice agar (CV8A) medium 49 at 23°C.

Zoospore-free fluid (ZFF) from a particular species is designated with an abbreviated species name. For example, ZFFnic represents ZFF from a P. nicotianae zoospore suspension. ZFF was prepared from nutrient-depleted zoospore suspensions starting with sporangium induction as described previously 18 21 . Specifically, prior to sporangium production, P. sojae and Py. aphanidermatum were cultured for 3-4 days and the other species were cultured for 1-2 wk in 10% CV8 broth. After nutrient depletion (medium removal and water rinses), the mycelial mats were further incubated for 16-18 h for P. sojae and Py. aphanidermatum, 2-3 days for P. capsici and one week for the other species under fluorescent light at 23°C to obtain a desired number of sporangia. To induce zoospore release, the mats with sporangia were flooded with chilled SDW and kept under lights until the desired zoospore density was reached. ZFF was obtained by passing a zoospore suspension through a 0.2 μm pore-size filter after vortexing for 2 min. ZFF was used fresh or stored at -20°C. Freezing destroyed the aggregation-promoting activity of ZFF, but not its infection-promoting activity.

Four phytopathosystems, P. nicotianae × annual vinca (Catharanthus roseus cv. Little Bright Eye), P. sojae × lupine (Lupinus polyphyllus), P. sojae × soybean (Glycine max cv. Williams) and P. capsici × pepper (Capsicum annum cv. California Wonder) were used.

Annual vinca plants were prepared in the greenhouse where 4-wk old seedlings were grown in pine bark with fertilizer for 4-6 wk. Soybean and pepper seedlings were prepared by growing 9 seeds per pot in sterilized Soilless Potting Mix (Schultz Professional) supplied with fertilizer and fungicide for 2 and 4 weeks, respectively, in the greenhouse. For lupine plants, 10 germinated seeds per styrofoam cup were grown in sterilized vermiculite (Whittemore Com) and fertilizer solution 20-20-20 (Scotts) for 2 wk in the growth chamber.

Single-zoospore inocula with an average concentration of one zoospore per drop (10 μl) were prepared by dilution of a fresh zoospore suspension at 10⁴ ml^-1 with a test solution to 100 zoospore ml^-1. Test solutions included SDW, dilutions from 1 mM purified AI-2 (Omm Scientific Inc, Dallas, TX) and ZFF from different species. To test whether ZFF was heat or freezing labile, ZFFnic boiled for 5 min or freeze thawed was also included. For determination of the infection threshold of P. capsici, the zoospore suspension was diluted in SDW to prepare inocula at 10², 10³ or 10⁴ ml^-1, containing an average of 1, 10, or 100 zoospores per 10-μl drop.

For inoculation with P. nicotianae, detached annual vinca leaves were used as described previously 18 . Each leaf was inoculated at 10 sites unless stated otherwise with a 10-μl drop of single zoospore inocula. Each treatment included six replicate leaves and was done at least three times.

In the P. sojae × lupine phytopathosystem, each cotyledon of lupine plants received one 10-μl drop of a single zoospore inoculum. Each treatment included 10 cups. Each cup contained 5-10 plants. Inoculated plants were kept in a moist chamber at 23°C in the dark overnight, then at a 10 h/14 h day/night cycle until symptoms appeared. Plants with damping-off symptoms were recorded as dead plants. Each assay was repeated twice.

Similarly, for soybean and pepper plant inoculation, two 10-μl drops of an inoculum containing single or multiple zoospores were placed on the hypocotyls of each plant which was laid on its side in a moist chamber. Inoculated plants were kept in the dark overnight and then placed upright in a growth chamber at 26°C until symptoms appeared. For soybean, each treatment included at least 3 replicate pots containing 7-9 plants and was repeated twice. For pepper plants, each inoculation was performed in 6 replicate pots containing 3-8 plants.

To determine zoospore responses to ZFF and other chemicals, 30 μl zoospore suspensions at 10⁴ zoospores ml^-1 were added to 120 μl of a test solution in a well on a depression slide to obtain a density of 2 × 10³ zoospores ml^-1. Test solutions included fresh or treated (boiled or freeze/thawed) ZFF, a serial dilution from purified AI-2 at 1 mM, or SDW. Each test contained two replicate wells per treatment and was repeated once. The slides were placed on wet filter paper in 10-cm Petri dishes and incubated at 23°C. Zoospore behaviors including encystment, aggregation, germination and differentiation in three random fields in each well were examined with an IX71 inverted microscope (Olympus America Inc., Pennsylvania, USA) after overnight incubation. Images were captured with the Image-Pro^® Plus software version 5.1 (Media Cybernetics, Inc, Maryland, USA).

The procedure was adopted from that for P. infestans 41 . To obtain a template for preparation of sense and antisense RNAs by transcription, two pairs of primers containing the T7 RNA polymerase promoter in their forward or reverse sequences were designed for amplification of a partial RPI sequence extracted from the P. capsici genome http://genome.jgi-psf.org/PhycaF7/PhycaF7.home.html. These primers were dsRPIPcapF: 5'-CAA GCT AAG CAG CTC ATC GCC CA-3'; dsRPIPcapRT7: 5'-GTA ATA CGA CTC ACT ATA GGG CAA CAG GCA CCC CCT GGG TCC A-3'; dsRPIPcapR: 5'-CAA CAG GCA CCC CCT GGG TCC A-3'(TGGACCCAGGGGGTGCCTGTTG); and dsRPIPcapFT7: 5'-GTA ATA CGA CTC ACT ATA GGG CAA GCT AAG CAG CTC ATC GCC CA-3'. Concentrated PCR amplicons were transcribed to produce sense and antisense RNAs using Megascrit RNAi kit (Ambion). Both sense and antisense RNA were mixed to obtain dsRNA at 168 ng μl^-1.

To silence RPI, P. capsici protoplasts were transfected with the dsRNA. For each transfection, 24 μl of dsRNA (4 μg) was dried under vacuum (20-30 min) and then suspended in 10 μl PEG and 0.8 M mannitol solutions, respectively then incubated with 10 μl Lipofectin (Invitrogen) for 15 min prior to mixing with 20 μl P. capsici protoplasts. Protoplasts were prepared using a modified transformation protocol for P. sojae 50 . After further incubation for 24 h at 23°C, the mixture was transferred to 200 ml pea broth with ampicillin and vancomycin then 4 ml was transferred into each well of 12-well plates.

To determine RPI expression in dsRNA-treated lines, mycelia from each well (line) were subcultured and extracted for RNA on day 7 using the Qiagen RNeasy plant kit. RNA was prepared from the lines before (T₀) and two weeks after transfer (T₁) as well as from the wild type culture. All the RNAs were treated with the RNase-Free DNAase Set (Qiagen), quantified and subjected to reverse transcription using the SuperScript III Reverse Transcriptase kit (Roche) followed by PCR using primers RPIPcapF: 5'- CAG ACG TCG CAG ATA CTA TTA ACC A-3'; and RPIPcapR: 5'-CTC CAG GAA GTA ATG CAT GAC ACA A-3' for RPI and actin housekeeping gene primers 50 for an endogenous control. The PCR products were then analyzed by electrophoresis.

Acyl-homoserine lactone (AHL) activity was determined with an Agrobacterium tumefaciens AHL reporter strain (KYC55/pJZ410/pJZ384/pJZ372) 46 . The reporter strain cannot produce AHLs but has plasmids containing a traI-lacZ reporter fusion and the regulator TraR driven by a T7 expression system. In the presence of exogenous AHLs, the over-expressed TraR activates the reporter fusion, resulting in production of β-galactosidase. The reporter can detect a broad range of AHLs ranging from 4- to 18-carbon acyl moieties at nanomolar levels 46 . We monitored LacZ activity by observing X-gal hydrolysis colorimetrically in the culture plates 51 and quantified the activity using the lactose analog ONPG (orthonitrophenyl-galactopyranoside) in a spectrophotometric assay 46 . ZFFnic and ZFFsoj from different zoospore suspensions, their ethyl acetate extracts, four positive controls (N-hexanoyl-, N-octanoyl-, N-decanoyl-, and dodecanoyl-DL-homoserine lactones (Sigma-Aldrich, Atlanta, Georgia, US) and a negative control (SDW) were included in the experiments. All AHLs were assessed at concentrations of 10 nM and 100 nM.

In plate assays, 10 μl of ZFF, a synthetic AHL or SDW was injected at the center of the test plates with a pipette once the overlay was set. After incubation at 28°C for 2 days, LacZ activity was measured by the diameter of the blue area in test plates. The experiments were performed four times, and each experiment had two replicate plates. In spectrophotometric assays, the reporter was pre-induced in the AT medium containing antibiotics and stored at -80°C. The thawed cells were resuspended in AT medium (1:1000). A 200-μl aliquot of ZFF or SDW, or 50 μl of synthetic AHL was added to glass tubes containing 2 ml suspension. Cultures were grown on a shaker at 28°C until OD₆₀₀ = 1.0 (1.5 days). The bacterial cells in each tube were lysed by the addition of 800 μl of Z buffer, 20 μl of 0.05% SDS and 30 μl of chloroform followed by vortexing. LacZ activity was measured using the Miller Unit at OD₄₂₀ for the supernatant after the reaction with 100 μl of ONPG was ended by 1 M Na₂CO₃. The experiment was carried out in replicate and performed twice.

Data from independent experiments were processed and statistically analyzed using ANOVA in Excel. All P-values were determined based on one-way ANOVA unless otherwise stated.